I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts.
For example, given the input string: ATGAACATAGGACATGAGGAGTCA
I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results.
I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.
If you really want to use regular expressions, try this:
var str = "ATGAACATAGGACATGAGGAGTCA",
re = /ATG.*/g, match, matches=[];
while ((match = re.exec(str)) !== null) {
matches.push(match);
re.lastIndex = match.index + 3;
}
But be careful with exec and changing the index. You can easily make it an infinite loop.
Otherwise you could use indexOf to find the indices and substr to get the substrings:
var str = "ATGAACATAGGACATGAGGAGTCA",
offset=0, match=str, matches=[];
while ((offset = match.indexOf("ATG", offset)) > -1) {
match = match.substr(offset);
matches.push(match);
offset += 3;
}
I think you want is
var subStrings = inputString.split('ATG');
KISS :)
Splitting a string before each occurrence of ATG is simple, just use
result = subject.split(/(?=ATG)/i);
(?=ATG) is a positive lookahead assertion, meaning "Assert that you can match ATG starting at the current position in the string".
This will split GGGATGTTTATGGGGATGCCC into GGG, ATGTTT, ATGGGG and ATGCCC.
So now you have an array of (in this case four) strings. I would now go and take those, discard the first one (this one will never contain nor start with ATG) and then join the strings no. 2 + ... + n, then 3 + ... + n etc. until you have exhausted the list.
Of course, this regex doesn't do any validation as to whether the string only contains ACGT characters as it only matches positions between characters, so that should be done before, i. e. that the input string matches /^[ACGT]*$/i.
Since you want to capture from every "ATG" to the end split isn't right for you. You can, however, use replace, and abuse the callback function:
var matches = [];
seq.replace(/atg/gi, function(m, pos){ matches.push(seq.substr(pos)); });
This isn't with regex, and I don't know if this is what you consider "elegant," but...
var sequence = 'ATGAACATAGGACATGAGGAGTCA';
var matches = [];
do {
matches.push('ATG' + (sequence = sequence.slice(sequence.indexOf('ATG') + 3)));
} while (sequence.indexOf('ATG') > 0);
I'm not completely sure if this is what you're looking for. For example, with an input string of ATGabcdefghijATGklmnoATGpqrs, this returns ATGabcdefghijATGklmnoATGpqrs, ATGklmnoATGpqrs, and ATGpqrs.
Related
So, as a relatively new programmer, I'm trying to create a very simple ASCII hangman game. I'm trying to figure out how to create a string of underscore's(_) based on the length of the word chosen.
For example, take the word Kaiser, I'd like to take, 'word.length(where word = "Kaiser")and convert it to "_ _ _ _ _ _`". Thanks in advance!
My first guess is something like this would work.
var underscored = string.split('').map(function(char) {
return char = '_ ';
}).join('');
Get every character in the string with the split function, and change the state of every character, using the map function. However, this will just give us an array. We need to perform type conversion again to turn it back to a string. To do this, we can use the join method. The delimiter we join is simply an empty string ''.
Another possibility is with the replace function
var underscored = string.replace(/./g, '_ ');
The regular expression here is very simple. The period . indicates any character. The global(g) flag means find all instances of the previous regex.
The second parameter of this function is what we want these characters to become. Since we want a space between underscores, this will be _.
Note that the replace method is not destructive. In other words, it does not modify the original array. You would need to store this in a separate variable. Because if you call string again, kaiser will be returned.
var str = "Kaiser";
var resStr = "";
for (i = 0; i < str.length; i++) {
resStr = resStr + " _";
}
You don't have to replace anything just create new string based on length of the first word, example :
var underscore_word = Array(word.length).join("_ ");
Take a look at Repeat Character N Times.
Hope this helps.
I have a string that can be a comma separated list of \w, such as:
abc123
abc123,def456,ghi789
I am trying to find a JavaScript regexp that will return ['abc123'] (first case) or ['abc123', 'def456', 'ghi789'] (without the comma).
I tried:
^(\w+,?)+$ -- Nope, as only the last repeating pattern will be matched, 789
^(?:(\w+),?)+$ -- Same story. I am using non-capturing bracket. However, the capturing just doesn't seem to happen for the repeated word
Is what I am trying to do even possible with regexp? I tried pretty much every combination of grouping, using capturing and non-capturing brackets, and still not managed to get this happening...
If you want to discard the whole input when there is something wrong, the simplest way is to validate, then split:
if (/^\w+(,\w+)*$/.test(input)) {
var values = input.split(',');
// Process the values here
}
If you want to allow empty value, change \w+ to \w*.
Trying to match and validate at the same time with single regex requires emulation of \G feature, which assert the position of the last match. Why is \G required? Since it prevents the engine from retrying the match at the next position and bypass your validation. Remember than ECMA Script regex doesn't have look-behind, so you can't differentiate between the position of an invalid character and the character(s) after it:
something,=bad,orisit,cor&rupt
^^ ^^
When you can't differentiate between the 2 positions, you can't rely on the engine to do a match-all operation alone. While it is possible to use a while loop with RegExp.exec and assert the position of last match yourself, why would you do so when there is a cleaner option?
If you want to savage whatever available, torazaburo's answer is a viable option.
Live demo
Try this regex :
'/([^,]+)/'
Alternatively, strings in javascript have a split method that can split a string based on a delimeter:
s.split(',')
Split on the comma first, then filter out results that do not match:
str.split(',').filter(function(s) { return /^\w+$/.test(s); })
This regex pattern separates numerical value in new line which contains special character such as .,,,# and so on.
var val = [1234,1213.1212, 1.3, 1.4]
var re = /[0-9]*[0-9]/gi;
var str = "abc123,def456, asda12, 1a2ass, yy8,ghi789";
var re = /[a-z]{3}\d{3}/g;
var list = str.match(re);
document.write("<BR> list.length: " + list.length);
for(var i=0; i < list.length; i++) {
document.write("<BR>list(" + i + "): " + list[i]);
}
This will get only "abc123" code style in the list and nothing else.
May be you can use split function
var st = "abc123,def456,ghi789";
var res = st.split(',');
now I have two strings,
var str1 = "A10B1C101D11";
var str2 = "A1B22C101D110E1";
What I intend to do is to tell the difference between them, the result will look like
A10B1C101D11
A10 B22 C101 D110E1
It follows the same pattern, one character and a number. And if the character doesn't exist or the number is different between them, I will say they are different, and highlight the different part. Can regular expression do it or any other good solution? thanks in advance!
Let me start by stating that regexp might not be the best tool for this. As the strings have a simple format that you are aware of it will be faster and safer to parse the strings into tokens and then compare the tokens.
However you can do this with Regexp, although in javascript you are hampered by the lack of lookbehind.
The way to do this is to use negative lookahead to prevent matches that are included in the other string. However since javascript does not support lookbehind you might need to go search from both directions.
We do this by concatenating the strings, with a delimiter that we can test for.
If using '|' as a delimiter the regexp becomes;
/(\D\d*)(?=(?:\||\D.*\|))(?!.*\|(.*\d)?\1(\D|$))/g
To find the tokens in the second string that are not present in the first you do;
var bothstring=str2.concat("|",str1);
var re=/(\D\d*)(?=(?:\||\D.*\|))(?!.*\|(.*\d)?\1(\D|$))/g;
var match=re.exec(bothstring);
Subsequent calls to re.exec will return later matches. So you can iterate over them as in the following example;
while (match!=null){
alert("\""+match+"\" At position "+match.index);
match=re.exec(t);
}
As stated this gives tokens in str2 that are different in str1. To get the tokens in str1 that are different use the same code but change the order of str1 and str2 when you concatenate the strings.
The above code might not be safe if dealing with potentially dirty input. In particular it might misbehave if feed a string like "A100|A100", the first A100 will not be considered as having a missing object because the regexp is not aware that the source is supposed to be two different strings. If this is a potential issue then search for occurences of the delimiting character.
You call break the string into an array
var aStr1 = str1.split('');
var aStr2 = str2.split('');
Then check which one has more characters, and save the smaller number
var totalCharacters;
if(aStr1.length > aStr2.length) {
totalCharacters = aStr2.length
} else {
totalCharacters = aStr1.length
}
And loop comparing both
var diff = [];
for(var i = 0; i<totalCharacters; i++) {
if(aStr1[i] != aStr2[i]) {
diff.push(aStr1[i]); // or something else
}
}
At the very end you can concat those last characters from the bigger String (since they obviously are different from the other one).
Does it helps you?
I have a text string that can be any number of characters that I would like to attach an order number to the end. Then I can pluck off the order number when I need to use it again. Since there's a possibility that the number is variable length, I would like to do a regular expression that catch's everything after the = sign in the string ?order_num=
So the whole string would be
"aijfoi aodsifj adofija afdoiajd?order_num=3216545"
I've tried to use the online regular expression generator but with no luck. Can someone please help me with extracting the number on the end and putting them into a variable and something to put what comes before the ?order_num=203823 into its own variable.
I'll post some attempts of my own, but I foresee failure and confusion.
var s = "aijfoi aodsifj adofija afdoiajd?order_num=3216545";
var m = s.match(/([^\?]*)\?order_num=(\d*)/);
var num = m[2], rest = m[1];
But remember that regular expressions are slow. Use indexOf and substring/slice when you can. For example:
var p = s.indexOf("?");
var num = s.substring(p + "?order_num=".length), rest = s.substring(0, p);
I see no need for regex for this:
var str="aijfoi aodsifj adofija afdoiajd?order_num=3216545";
var n=str.split("?");
n will then be an array, where index 0 is before the ? and index 1 is after.
Another example:
var str="aijfoi aodsifj adofija afdoiajd?order_num=3216545";
var n=str.split("?order_num=");
Will give you the result:
n[0] = aijfoi aodsifj adofija afdoiajd and
n[1] = 3216545
You can substring from the first instance of ? onward, and then regex to get rid of most of the complexities in the expression, and improve performance (which is probably negligible anyway and not something to worry about unless you are doing this over thousands of iterations). in addition, this will match order_num= at any point within the querystring, not necessarily just at the very end of the querystring.
var match = s.substr(s.indexOf('?')).match(/order_num=(\d+)/);
if (match) {
alert(match[1]);
}
have a regex problem :(
what i would like to do is to find out the contents between two or more numbers.
var string = "90+*-+80-+/*70"
im trying to edit the symbols in between so it only shows up the last symbol and not the ones before it. so trying to get the above variable to be turned into 90+80*70. although this is just an example i have no idea how to do this. the length of the numbers, how many "sets" of numbers and the length of the symbols in between could be anything.
many thanks,
Steve,
The trick is in matching '90+-+' and '80-+/' seperately, and selecting only the number and the last constant.
The expression for finding the a number followed by 1 or more non-numbers would be
\d+[^\d]+
To select the number and the last non-number, add parens:
(\d+)[^\d]*([^\d])
Finally add a /g to repeat the procedure for each match, and replace it with the 2 matched groups for each match:
js> '90+*-+80-+/*70'.replace(/(\d+)[^\d]*([^\d])/g, '$1$2');
90+80*70
js>
Or you can use lookahead assertion and simply remove all non-numerical characters which are not last: "90+*-+80-+/*70".replace(/[^0-9]+(?=[^0-9])/g,'');
You can use a regular expression to match the non-digits and a callback function to process the match and decide what to replace:
var test = "90+*-+80-+/*70";
var out = test.replace(/[^\d]+/g, function(str) {
return(str.substr(-1));
})
alert(out);
See it work here: http://jsfiddle.net/jfriend00/Tncya/
This works by using a regular expression to match sequences of non-digits and then replacing that sequence of non-digits with the last character in the matched sequence.
i would use this tutorial, first, then review this for javascript-specific regex questions.
This should do it -
var string = "90+*-+80-+/*70"
var result = '';
var arr = string.split(/(\d+)/)
for (i = 0; i < arr.length; i++) {
if (!isNaN(arr[i])) result = result + arr[i];
else result = result + arr[i].slice(arr[i].length - 1, arr[i].length);
}
alert(result);
Working demo - http://jsfiddle.net/ipr101/SA2pR/
Similar to #Arnout Engelen
var string = "90+*-+80-+/*70";
string = string.replace(/(\d+)[^\d]*([^\d])(?=\d+)/g, '$1$2');
This was my first thinking of how the RegEx should perform, it also looks ahead to make sure the non-digit pattern is followed by another digit, which is what the question asked for (between two numbers)
Similar to #jfriend00
var string = "90+*-+80-+/*70";
string = string.replace( /(\d+?)([^\d]+?)(?=\d+)/g
, function(){
return arguments[1] + arguments[2].substr(-1);
});
Instead of only matching on non-digits, it matches on non-digits between two numbers, which is what the question asked
Why would this be any better?
If your equation was embedded in a paragraph or string of text. Like:
This is a test where I want to clean up something like 90+*-+80-+/*70 and don't want to scrap the whole paragraph.
Result (Expected) :
This is a test where I want to clean up something like 90+80*70 and don't want to scrap the whole paragraph.
Why would this not be any better?
There is more pattern matching, which makes it theoretically slower (negligible)
It would fail if your paragraph had embedded numbers. Like:
This is a paragraph where Sally bought 4 eggs from the supermarket, but only 3 of them made it back in one piece.
Result (Unexpected):
This is a paragraph where Sally bought 4 3 of them made it back in one piece.